Bộ công thương

Công nghệ sinh học

Thứ tư, 16/10/2019 | 13:54

Thứ tư, 16/10/2019 | 13:54

Ứng dụng khác

Cập nhật lúc 01:35 ngày 09/10/2019

Phân lập và tuyển chọn nấm men có khả năng lên men rượu vang thanh long ruột đỏ (Hylocereus polyrhizus)

Tóm tắt:
Nghiên cứu được thực hiện với mục đích phân lập và tuyển chọn nấm men có hoạt tính lên men cao nhằm ứng dụng lên men rượu vang thanh long ruột đỏ (Hylocereus polyrhizus). Kết quả nghiên cứu đã phân lập được 29 chủng nấm men từ 12 mẫu trái thanh long trồng tại các tỉnh/thành phố Cần Thơ, Hậu Giang, Vĩnh Long, Đồng Tháp và Bến Tre. Dựa vào khóa phân loại nấm men (hình thái, sinh lý, sinh hóa) đã xác định được đặc điểm của các dòng nấm men được phân lập từ thanh long. Tuyển chọn được chủng nấm men BT2.1 được phân lập từ dịch quả thanh long ruột đỏ tại huyện Chợ Lách (Bến Tre) cho hàm lượng ethanol cao nhất (11,17% v/v) và đường sót thấp nhất (8,33oBrix). Rượu vang thanh long ruột đỏ lên men từ chủng nấm men BT2.1 với dịch quả được bổ sung đường saccharose ở 22°Brix, pH 4,5, mật số nấm men 106 tế bào/ml và lên men ở nhiệt độ phòng trong 7 ngày cho kết quả độ rượu đạt 12,15% v/v. Kết quả định danh chủng nấm men BT2.1 bằng phương pháp giải trình tự DNA đã xác định được BT2.1 tương đồng với Saccharomyces cerevisiae.
Từ khóa: Hylocereus polyrhizus, rượu vang, Saccharomyces cerevisiae, thanh long ruột đỏ.
Đặt vấn đề
Từ hàng nghìn năm trước, con người đã biết sử dụng nấm men để chế biến thực phẩm và ngày nay vai trò của nấm men cũng rất quan trọng trong đời sống. Nấm men   có mặt trong quá trình chế biến nhiều loại thực phẩm như rượu, bia, bánh mì… và có vai trò quan trọng trong cung cấp dinh dưỡng cần thiết cho con người, trong đó rượu vang là một trong những sản phẩm đã có từ rất lâu đời và được sử dụng phổ biến ở nhiều nước trên thế giới [1]. Hiện nay, rượu vang ngày càng phổ biến ở Việt Nam bởi những đặc tính tốt của nó đối với sức khỏe, cùng với nguồn nguyên liệu làm rượu vang ở nước ta đa dạng và phong phú như: nho, xoài, cam, mơ… Thanh long là loại trái cây có màu đỏ sáng hấp dẫn ở vỏ và thịt quả, dịch quả rất giàu dinh dưỡng và rất tốt cho sức khỏe con người. Đặc biệt, thanh long ruột đỏ (Hylocereus polyrhizus) có thành phần dinh dưỡng được đánh giá cao gấp đôi thanh long ruột trắng. Thanh long ruột đỏ chứa đầy đủ các chất dinh dưỡng vi lượng cần thiết cho cơ thể, bao gồm nhiều loại vitamin như vitamin C, vitamin A, protein, lycopen, glucid,... và khoáng chất [2].
Nấm men nhìn chung được sử dụng là nguồn giống vi sinh vật chính trong lên men rượu vang, nhưng tùy vào đặc điểm của từng loại nguyên liệu khác nhau mà sẽ có các chủng nấm men thích hợp để tạo ra được sản phẩm rượu vang với hàm lượng ethanol cao và có mùi vị đặc trưng. Do đó, đã có nhiều nghiên cứu phân lập, tuyển chọn và ứng dụng chủng nấm men thích hợp cho lên men với từng loại nguyên liệu trái cây cụ thể để tạo nên sản phẩm rượu vang đặc trưng, như rượu vang khóm [3], rượu vang cam [4], rượu vang dưa hấu [5], rượu vang thanh long ruột trắng  [6]… Tuy nhiên, việc nghiên cứu về rượu vang thanh long ruột đỏ chưa được đề cập nhiều cũng như chưa có những kết quả công bố về chủng nấm men thích hợp để sản xuất rượu vang thanh long ruột đỏ. Chính vì vậy, việc cho ra đời sản phẩm rượu vang thanh long ruột đỏ không chỉ đáp ứng nhu cầu về thức uống bổ dưỡng, có ích đối với sức khoẻ mà còn đáp ứng được nhu cầu ngày càng cao của xã hội về mặt đa dạng hoá sản phẩm, tạo ra sản phẩm mới có hương vị đặc trưng, giúp người tiêu dùng dễ dàng trong việc lựa chọn sản phẩm. Để phát triển sản phẩm rượu vang thanh long ruột đỏ, ngoài hoàn thiện quy trình lên men thì việc tìm kiếm chủng nấm men thích hợp cho lên men là rất cần thiết nhằm tạo ra sản phẩm đặc trưng.
Đối tượng và phương pháp nghiên cứu
Nguyên vật liệu, hóa chất và môi trường
- Mẫu thanh long được thu tại các địa điểm: quận Ô Môn và quận Ninh Kiều (TP Cần Thơ), thị xã Bình Minh (Vĩnh Long), TP Vị Thanh (Hậu Giang), huyện Lai Vung (Đồng Tháp), huyện Chợ Lách (Bến Tre).
- Chủng nấm men Saccharomyces cerevisiae AWRI796 (Viện Nghiên cứu Rượu vang Úc) được lưu trữ tại Phòng thí nghiệm Công nghệ sinh học thực phẩm, Trường Đại học Cần Thơ.
- Enzyme pectinase được mua từ sản phẩm enzyme thương mại (Angel pectinase) của Công ty Angel Yeast Co., Ltd.
- Môi trường yeast extract - peptone - D-glucose (YPD, yeast extract 0,5%; peptone 0,5%; D-glucose 2,0%) và môi trường YPD agar (môi trường YPD bổ sung 1,5 g/l agar). Môi trường Christensen (urea 20 g/l; yeast extract 0,1 g/l; Na2HPO4 9,5 g/l; K2HPO4 9,1 g/l; phenol red 0,01 g/l; pH 6,7) [7].
Các hóa chất sử dụng được mua từ sản phẩm thương mại của Merck (Đức) và HiMedia (Ấn Độ).
Phương pháp nghiên cứu
Phân lập và xác định các đặc điểm hình thái và sinh hóa của nấm men: thanh long thu về không tách bỏ vỏ, loại bỏ những quả hư, nhiễm vi sinh vật gây hư hỏng quả. Cắt và cho cả vỏ và thịt quả thanh long ruột đỏ vào bình tam giác 100 ml có môi trường YPD tăng sinh ở nhiệt độ phòng trong 24 giờ. Tiến hành phân lập trên môi trường YPD agar đến khi có được những dòng nấm men thuần chủng. Các đặc điểm về hình thái và sinh hóa cơ bản của nấm men như hình dạng và kích thước tế bào nấm men, khả năng lên men đường saccharose và glucose, hoạt tính phân giải urea được thực hiện dựa vào các khóa phân loại nấm men chuẩn [1,  7, 8].
Tuyển chọn nấm men có hoạt lực lên men cao từ các dòng nấm men phân lập: thử nghiệm nhằm so sánh khả năng lên men và chọn ra dòng nấm men có hoạt lực lên men mạnh nhất để lên men rượu vang thanh long ruột đỏ. Dịch quả thanh long thu được bằng cách sử dụng máy ép dịch quả Panasonic MJ-W176P và được xử lý bằng enzyme pectinase 0,2% [9] trong 8 giờ ở 30°C. Phối chế dịch quả thanh long ruột đỏ bằng đường saccharose đến 22oBrix, điều chỉnh pH 4,5 và thanh trùng với NaHSO3 (140 mg/l) trong 2 giờ. Nuôi cấy tế bào nấm men trong môi trường tăng sinh YPD đến khi mật số tế bào nấm men đạt 108 tế bào/ml dịch lên men. Cho 9 ml dịch quả vào ống nghiệm có ống Durham, tiếp tục cho vào 1 ml dung dịch các dòng nấm men, lắc đều và ủ ở 30°C.
Song song đó, tiến hành đánh giá khả năng lên men trong bình tam giác để xác định hàm lượng ethanol sinh ra và so sánh với chủng đối chứng là S. cerevisiae AWRI796. Dịch quả thanh long ruột đỏ được xử lý enzyme pectinase 0,2%, sau đó được phối chế ở 22oBrix, điều chỉnh pH 4,5 và thanh trùng với NaHSO3, (140 mg/l) trong 2 giờ. Chủng 1 ml dịch nấm men và 99 ml dịch quả chứa trong bình tam giác 250ml, đậy kín bằng waterlock và lên men 7 ngày ở nhiệt độ 30°C. Xác định độ rượu và độ Brix sau lên men. Tuyển chọn được chủng nấm men có hoạt lực lên men tốt nhất dựa vào khả năng lên men nhanh và cho độ rượu cao nhất.
Định danh nấm men được tuyển chọn bằng phương pháp giải trình tự gen: chủng nấm men có hoạt lực lên men mạnh nhất được chọn để giải trình tự đoạn gen với cặp  mồi ITS1 (5’-TCCGTAGGTGAACCTGCGG-3’) và ITS4 (5’-TCCTCCGCTTATTGATA TGC-3’) [10] và sử dụng
chương trình Nucleotide Blast để so sánh mức độ tương đồng của trình tự được giải với trình tự của các dòng nấm men trong ngân hàng gen NCBI với phần mềm BLASTN.
Các chỉ tiêu phân tích và xử lý thống kê: pH được đo bằng pH kế (Sartorius, PB-20, Đức), độ Brix được xác định bằng khúc xạ kế (Hand Refractometer, FG103/113, Euromex, Hà Lan) và hàm lượng ethanol hình thành được xác định bằng phương pháp chưng cất và hiệu chỉnh về 20oC [11]. Số liệu thu thập được xử lý thống kê bằng phần mềm Statgraphics Centurion XV.I. (Statpoint Technologies, Inc., USA).
Kết quả và thảo luận
Đặc điểm hình thái của nấm men phân lập
Kết quả đã phân lập được 29 chủng nấm men từ 12 mẫu thanh long ruột đỏ ban đầu (bảng 1). Kết quả cho thấy sự đa dạng về hình dạng tế bào của các chủng nấm men phân lập bao gồm hình cầu lớn, hình cầu nhỏ, hình ovan lớn, hình ovan nhỏ, hình elip lớn và hình elip nhỏ. Hình dạng các chủng nấm men phân lập được cũng khá đa dạng như trong nghiên cứu phân lập nấm men của Nguyễn Văn Thành và cs [3] và của H.X. Phong và cs [12]. Nhìn chung, hình dạng khuẩn lạc có các đặc điểm chung là tròn đều, bề mặt bóng, dạng mô nổi và bìa nguyên với màu sắc chủ yếu là trắng ngà và trắng sữa với dường kính khuẩn lạc dao động từ 0,5 đến 4 mm. Kết quả quan sát hình thức nảy chồi của tế bào nấm men cho thấy cả 29 chủng phân lập đều có hình thức nảy chồi nhiều hướng.
Bảng 1. Hình dạng các chủng nấm men được phân lập từ thanh long ruột đỏ.
Kết quả mô tả các đặc điểm hình thái tế bào nấm men cho thấy, 29 chủng nấm men có thể xếp thành 6 nhóm hình dạng đặc trưng (hình 1).
Hình 1. Hình dạng 6 nhóm nấm men. (1): hình cầu lớn, (2): hình cầu nhỏ, (3): hình ovan lớn, (4): hình ovan nhỏ, (5): hình elip lớn, (6): hình elip nhỏ.
Khả năng lên men đường glucose, saccharose và phân giải urea
Khả năng lên men các loại đường là một trong những chỉ tiêu quan trọng được sử dụng để phân loại nấm men. Khả năng lên men đường của 29 chủng nấm men phân lập được nuôi cấy trên các loại đường glucose và saccharose (2% w/v) trong ống nghiệm 10 ml có ống Durham (theo phương pháp của Kurtzman và Fell [8]) được thể hiện ở bảng 2. Nhìn chung, 29 chủng nấm men thuộc 6 nhóm phân lập được đều lên men đường glucose. Ngoài ra, nhóm 1 (cầu lớn), nhóm 2 (cầu nhỏ), nhóm 3 (ovan lớn), nhóm 4 (ovan nhỏ), nhóm 5 (elip lớn) lên men đường saccharose trừ chủng NK1.1 và BM2.1 và nhóm (6) không lên men được đường saccharose.
Sự thay đổi màu sắc của môi trường Christensen khi nuôi cấy nấm men phân lập sau thời gian ủ 7 ngày thể hiện hoạt tính phân giải urea của các dòng nấm men. Nấm men có khả năng sinh enzyme urease để phân giải urea thì môi trường sẽ chuyển sang màu đỏ sẫm. Khi nấm men có enzyme urease để phân giải urea thành CO2 và NH3, lượng NH3 tăng lên làm pH tăng khiến môi trường chuyển sang màu đỏ thông qua chất chỉ thị màu phenol red [7]. Kết quả quan sát sự chuyển màu được thể hiện ở bảng 2, trong đó các chủng nấm men BM1.2 (nhóm 2, cầu nhỏ); NK1.1, BM2.1 (nhóm 5, elip lớn) và LV1.1, BM1.1 (nhóm 6, elip nhỏ) làm thay đổi màu sắc môi trường Christensen từ màu vàng sang màu hồng nên các chủng này có khả năng phân giải urea. Nhóm 1 (cầu lớn), nhóm 2 (cầu nhỏ trừ BM1.2), nhóm 3 (ovan lớn), nhóm 4 (ovan nhỏ), nhóm 5 (elip lớn trừ NK1.1 và BM2.1), nhóm 6 (elip nhỏ trừ LV1.1 và BM1.1) không có khả năng phân giải urea.
Bảng 2. Đặc điểm hình thái và sinh hóa của 29 chủng nấm men.
Hoạt tính lên men của các dòng nấm men phân lập
Khả năng lên men của các dòng nấm men phân lập: kết quả cho thấy lượng khí CO2 sinh ra ở các nghiệm thức là khác nhau khá nhiều. Nhìn chung, hầu hết các chủng nấm men thử nghiệm đều sinh khí CO2 đạt tối đa chiều cao ống Durham (30 mm), trừ các dòng OM1.2, OM2.2, OM2.3, NK1.1, NK1.2, NK2.2, BM1.1, BM1.2, BM2.1, BM2.2, VT1.2, VT2.1, LV1.1, LV1.2 và LV2.1. Chiều cao cột khí CO2 đạt tối đa nhanh nhất là dòng nấm men BT2.1 ở thời điểm 8 giờ sau lên men, tiếp đến là dòng BT2.2 ở thời điểm 12 giờ. Như vậy, 14 chủng nấm men OM1.1, OM2.1, NK1.3,  NK2.1,  NK2.3,  BM1.3,  VT1.1,  VT2.2,  LV2.2, BT1.1, BT1.2, BT1.3, BT2.1 và BT2.2 được sơ tuyển dựa trên khả năng hình thành khí CO2 đạt giá trị tối đa (30 mm) sau 14 giờ lên men.
Hoạt tính lên men dịch quả của các dòng nấm men phân lập: thí nghiệm thực hiện khảo sát khả năng lên men của các dòng nấm men phân lập được. Mười bốn chủng nấm men (OM1.1, OM2.1, NK1.3, NK2.1, NK2.3, BM1.3, VT1.1, VT2.2,  LV2.2,  BT1.1,  BT1.2,  BT1.3,  BT2.1,  BT2.2) sơ tuyển tiếp tục được đánh giá khả năng lên men dịch quả thanh long ruột đỏ và so sánh với chủng đối chứng S. cerevisiae AWRI796. Thí nghiệm được tiến hành với mật số nấm men 106 tế bào/ml, thời gian ủ là 10 ngày ở 30°C, pH 4,5 và 22oBrix. Độ Brix sau lên men còn lại trong khoảng 8,33-16,00 (bảng 3), giảm so với ban đầu (22oBrix) do trong quá trình lên men, nấm men sử dụng đường làm nguồn carbon chủ yếu để lên men tạo ra sản phẩm rượu. pH dịch lên men dao động trong khoảng 3,65-4,89.
Bảng 3. Độ cồn và độ Brix sau lên men của các dòng nấm men.
Ghi chú: số liệu trong bảng là trung bình của 3 lần lặp lại, trong cùng một cột các số mang chữ số mũ giống nhau thì không khác biệt có ý nghĩa thống kê 5% (P<0,05). ĐC: chủng đối chứng S. cerevisiae AWRI796.

Kết quả cho thấy, các chủng nấm men NK2.3, BT1.3, BT2.1 và BT2.2 sinh hàm lượng ethanol tốt nhất trong khoảng 10,84-11,17% v/v  và  không  khác  biệt  ý  nghĩa  ở mức 5%. Cụ thể hàm lượng ethanol sinh ra lần lượt từ chủng NK2.3, BT1.3, BT2.1, BT2.2 là 10,84, 10,91, 11,17,
10,91% v/v và khác biệt ý nghĩa ở mức 5% so với các dòng nấm men còn lại. Kết quả các chủng nấm men tuyển chọn cho hàm lượng ethanol đạt yêu cầu ứng dụng trong sản xuất rượu vang tương đương với các nghiên cứu lên men rượu vang cam (13,0% v/v) [4], rượu vang khóm (10,03% v/v) [13], rượu vang trái giác (8,95% v/v) [14].
Xác nhận chủng nấm men lên men rượu vang thanh long ruột đỏ
Thí nghiệm nhằm khẳng định khả năng lên men của 4 dòng nấm men phân lập được tuyển chọn (NK2.3, BT1.3, BT2.1, BT2.2) và so sánh với chủng S. cerevisiae AWRI796. Thử nghiệm được thực hiện lặp lại 3 lần và kết quả được thể hiện ở bảng 4.
Bảng 4. Hàm lượng ethanol, pH và độ Brix sau lên men.
Số liệu trong bảng là trung bình của 3 lần lặp lại, trong cùng một cột các số mang chữ số mũ giống nhau thì không khác biệt có ý nghĩa thống kê 5% (P<0,05). ĐC: chủng đối chứng S. cerevisiae AWRI796.

Như vậy, từ kết quả hàm lượng ethanol và độ Brix kết hợp với kết quả cột khí CO2 của ống Durham cho thấy, chủng BT2.1 cho kết quả hàm lượng ethanol cao nhất (12,15% v/v) và độ Brix sau lên men thấp nhất (8oBrix), thời gian cột khí CO2 đạt tối đa (8 giờ) ngắn nhất so với các chủng nấm men còn lại. Từ những kết quả trên cho thấy, dòng BT2.1 cho kết quả tốt nhất và được tuyển chọn để ứng dụng lên men dịch thanh long ruột đỏ. Kết quả thu được có sự tương đồng khi lên men rượu vang thanh long ruột trắng với dòng nấm men TGK5 (11,83% v/v) [6].
Định danh nấm men phân lập BT2.1 bằng phương pháp giải trình tự
Dòng nấm men BT2.1 được định danh bằng phương pháp giải trình tự và phân tích trình tự gen 28S rRNA. Kết quả giải trình tự trên đoạn gen 28S rRNA của dòng nấm men BT2.1 như sau:
G G G T G A A T T T A A T A T T T T G A A A T G - G ATTTTTTTGTTTTGGCAAGAGC ATGA - GAGCTTTTACTGGGCAAGAAGACTAGAGATG- GAGAGTCCAGCCGGGCCTGCGCTTAAGTGCG- CGGTCTTGCTAGGCTTGTAAGTTTCTTTCTTGC- TATTCCAAACGGTGAGAGATTTCTGTGCTTTTGT- T AT AGGACA ATT AAAACCGTT TCA AT A - CAACACACT GT GGAGT T T T C ATAT CT T T G - CAACTTTTTCTTTGGGCATTCGAGCAATCGGGG- CCCAGAGGTAACAAACACAAACAATTTTATTTAT- TCATTAAATTTTTGTCAAAAACAAGAATTTTCG- TAACTGGAAATTTTAAAATATTAAAAACTTTCAA- CAACGG ATCTCTTGGTTCTCGC ATCG AT- GAAGAACGCAGCGAAATGCGATACGTAATGT- GAATTGCAGAATTCCGTGAATCATCGAATCTTT- GAACGCACATTGCGCCCCTTGGTATTCCAGGGGG- CATGCCTGTTTGAGCGTCATTTCCTTCTCAAACAT- TCTGTTTGGTAGTGAGTGATACTCTTTGGAGTTA- ACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTT- TTTCCAAAGAGAGGTTTCTCTGCGTGCTTGAG- GTATAATGCAAGTACGGTCGTTTTAGGTTTTAC- CAACTGCGGCTAATCTTTTTTATACTGAGCGTATTG- GAACGTTATCGATAAGAAGAGAGCGTCTAGGC- GAACAATGTTCTTAAAGTTTGACCTCAAATCAGG- TAGGAGTACCCGCTGAACTTAAGCATATCAATAGG- CGGAGGAAGGGTCATTAAGGA

Trình tự đoạn gen được giải gồm 823 base nitrogen và đoạn gen này được so sánh với các gen 28S rRNA của nấm men trong ngân hàng gen NCBI với phần mềm BLASTN. Kết quả cho thấy, đoạn gen 28S rRNA của dòng nấm men BT2.1 có độ tương đồng đến 99% so với trình tự gen 28S rRNA của Saccharomyces cerevisiae (CP006454.1) (hình 2).

Hình 2. So sánh trình tự gen 28S rRNA của BT2.1 và của chủng Saccharomyces cerevisiae với số đăng ký CP006454.1.

Kết quả định danh đã xác định chủng BT2.1 (hình 3) là loài Saccharomyces cerevisiae, đây là loài nấm men hữu dụng trong công nghiệp sản xuất rượu, nó không chỉ lên men nước quả hay môi trường chứa hàm lượng đường cao mà còn tạo ra sản phẩm lên men với hương vị đặc trưng. Loài S. cerevisiae có thể lên men ở nồng độ rượu cao, được phân lập và lên men rượu vang dưa hấu (15,83% v/v) [5], rượu vang thốt nốt (13,7% v/v) [15] và rượu vang nho (16,2%) [16].

Hình 3. Hình dạng tế bào (ở vật kính 100X) và khuẩn lạc của dòng nấm men BT2.1

Kết luận
Kết quả nghiên cứu đã phân lập được 29 chủng nấm men từ thanh long ruột đỏ thu tại quận Ô Môn và quận Ninh Kiều (Cần Thơ), thị xã Bình Minh (Vĩnh Long), TP Vị Thanh (Hậu Giang), huyện Lai Vung (Đồng Tháp), huyện Chợ Lách (Bến Tre). Dựa trên mô tả đặc điểm hình thái và sinh hóa, bước đầu đã xác định được các chủng này thuộc 6 nhóm (hình cầu lớn, hình cầu nhỏ, hình ovan lớn, hình ovan nhỏ, hình elip lớn và hình elip nhỏ). Dòng nấm men BT2.1 phân lập từ dịch thanh long tại huyện Chợ Lách (Bến Tre) lên men tự nhiên là dòng nấm men có hoạt lực lên men cao nhất (độ rượu đạt được 12,15% v/v). Định danh bằng phương pháp giải trình tự đã xác định chủng BT2.1 là loài Saccharomyces cerevisiae.
TÀI LIỆU THAM KHẢO
Lương Đức Phẩm (2009), Nấm men công nghiệp, Nhà xuất bản Khoa học và Kỹ thuật.
Nguyễn Văn Kế (2001), Cây ăn quả nhiệt đới, Tập 1, Nhà xuất bản Nông nghiệp TP Hồ Chí Minh.
Nguyễn Văn Thành, Nguyễn Minh Thủy, Trần Thị Quế và Nguyễn Thị Mỹ Tuyền (2013), “Phân lập, tuyển chọn và định danh nấm men trong lên men rượu vang khóm”, Tạp chí Thủy sản và Công nghệ sinh học, 25, tr.27-35.
Nguyễn Phúc Trường (2011), Phân lập và tuyển chọn nấm men lên men tự nhiên dùng sản xuất rượu vang cam, Luận văn Thạc sĩ Công nghệ sinh học, Trường Đại học Cần Thơ.
Ngô Thị Phương Dung, Lý Huỳnh Liên Hương và Huỳnh 
Xuân Phong (2011), “Phân lập, tuyển chọn nấm men và xác định điều kiện ảnh hưởng quy trình lên men rượu vang dưa hấu”, Tạp chí Khoa học Trường Đại học Cần Thơ, 18B, tr.137-145.
Hồ Thanh Trúc (2011), Phân lập và tuyển chọn nấm men tự nhiên ứng dụng trong sản xuất rượu vang thanh long, Luận văn Thạc sĩ Công nghệ sinh học, Trường Đại học Cần Thơ.
Nguyễn Đức Lượng, Phan Thị Huyền và Nguyễn Ánh Tuyết (2006), Thí nghiệm công nghệ sinh học, tập 2: Thí nghiệm vi sinh vật học, Nhà xuất bản Đại học Quốc gia TP Hồ Chí Minh.
C.P. Kurtzman and J.W. Fell (1998), The Yeast: A Taxonomic study, 4th ed, Elsevier Science.
Nguyễn Minh Thủy (2010), “Ổn định và nâng cao chất lượng rượu vang sim bằng biện pháp hóa học và sinh học”, Tạp chí Khoa học Trường Đại học Cần Thơ, 14B, tr.195-204.
K.J. Martin, P.T. Rygiewicz (2005), “Fungal-specific PCR primers developed for analysis of the ITS region of environmental DNA extracts”, BMC Microbiology, 5(28), p.11.
Nguyễn Đình Thưởng và Nguyễn Thanh Hằng (2005), Công nghệ sản xuất và kiểm tra cồn etylic, Nhà xuất bản Khoa học và Kỹ thuật.
H.X. Phong, N.T.C. Giang, S. Nitiyon, M. Yamada, P. Thanonkeo, and N.T.P. Dung (2016), “Ethanol production from molasses at high temperature by thermotolerant yeasts isolated from cocoa”, Can Tho University Journal of Science, 3, pp.21-26.
Huỳnh Xuân Phong, Danh Minh Lợi, Nguyễn Ngọc Thạnh, Lê Phan Đình Quí, Bùi Hoàng Đăng Long, Pornthap Thanonkeo, Mamoru Yamada, Ngô Thị Phương Dung (2017), “Tuyển chọn nấm men chịu nhiệt và nghiên cứu điều kiện lên men rượu vang khóm”, Tạp chí Khoa học Trường Đại học Cần Thơ, 51B, tr.7-15.
Đoàn Thị Kiều Tiên, Lữ Hằng Nghi, Nguyễn Ngọc Thạnh, Huỳnh Xuân Phong, Hà Thanh Toàn, Ngô Thị Phương Dung (2018), “Phân lập và tuyển chọn nấm men chịu nhiệt lên men rượu vang trái giác (Cayratia trifolia L.)”, Tạp chí Khoa học Kỹ thuật Nông lâm nghiệp, 2, tr.55-64.
Nguyễn Minh Thủy, Nguyễn Văn Thành, Bùi Thị Thúy Ngân (2011), “Tuyển chọn các dòng nấm men được phân lập từ nước thốt nốt”, Tạp chí Khoa học Trường Đại học Cần Thơ, 18B, tr.117-126.
T. Miki, Y. Ito, K. Kuroha, S. Izawa (2008), “Potential of yeasts isolated in botrytized grape juice to be new wine yeasts”, Food Science and Technology Research, 14 (4), pp.345-350.
Phạm Thị Thu Thảo, Nguyễn Ngọc Anh Thư, Lê Thanh Duy, Nguyễn Ngọc Thạnh, Bùi Hoàng Đăng Long, Huỳnh Xuân Phong
Viện Nghiên cứu và Phát triển Công nghệ sinh học, Trường Đại học Cần Thơ
lên đầu trang